Review



e el r2603c dab kit bioss  (Bioss)


Bioz Verified Symbol Bioss is a verified supplier
Bioz Manufacturer Symbol Bioss manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 96
      Buy from Supplier

    Structured Review

    Bioss e el r2603c dab kit bioss
    E El R2603c Dab Kit Bioss, supplied by Bioss, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/e+el+r2603c+dab+kit+bioss/Rat+Catalase+(CAT)+ELISA+Kit/pm41345441-306-34-37
    Average 96 stars, based on 1 article reviews
    e el r2603c dab kit bioss - by Bioz Stars, 2026-09
    96/100 stars

    Images

    Related Articles

    Staining:

    Article Title: Diagnostic ultrasound-microbubble therapy promotes wound healing through miR-26b-5p-mediated GSK3β suppression.
    Article Snippet: Rabbit monoclonal anti-CD31 Abcam Cat#EPR17259 RRID:ab182981 Rabbit Polyclonal anti-Phospho-GSK3B Proteintech Cat#14850-1-AP RRID:ab2878085 Mouse monoclonal anti-GAPDH Proteintech Cat#60004-1-Ig RRID:ab2107436 Rabbit polyclonal anti-Phospho-AKT Proteintech Cat#28731-1-AP RRID:ab2881201 Mouse monoclonal anti-Phospho-Pi3k Proteintech Cat#60225-1-Ig RRID:11042594 Biological samples Sprague Dawley (SD) rats Chen Du Dossy N/A Chemicals, peptides, and recombinant proteins rno-miR-26b-5p inhibitor RiboBio N/A .. Hematoxylin-Eosin(HE) Stain Kit SOLARBIO Cat#G1120 Masson’s Trichrome Stain Kit SOLARBIO Cat#G1340 Rat TNF-α ELISA Kit Elabscience Cat#E-EL-R2856 Rat TGF-β ELISA Kit Elabscience Cat#E-EL-0162c Rat IL-1β ELISA Kit Elabscience Cat#E-EL-R0012c Rat VEGF ELISA Kit Elabscience CatE-EL-R2603c DAB kit Bioss Cat#C-0010 Dual-Luciferase® Reporter Assay System Promega Cat#E1910 Bulge-Loop miRNA qRT-PCR Starter Kit RiboBio Cat#C10211-2 Bulge-LoopTM miRNA qRT-PCR Primer RiboBio Cat#MQP-0102 PrimeScriptTM RT reagent Kit Takara Cat#RR037A 24-well Transwell plate Corning Cat#3422 96-well Transwell plates Corning Cat#3382 SonoVue Bracco H20120528 Experimental models: Cell lines Human umbilical vein endothelial cell line Pricella CP-H082 .. Sprague Dawley (SD) rats Chen Du N/A AR TIC LE IN PR ES S 26 Dossy Oligonucleotides rno-miR-26b-5p Forward(5’to 3’): TTCAAGTAATTCAGGATAGGT This paper N/A rno-miR-26b-5p Reverse(5’to 3’): GCAGGGTCCGAGGTATTC This paper N/A miR-433-3p Forward(5’to 3’): TCGGCAATCATGATGGGC This paper N/A miR-433-3p Reverse(5’to 3’): CTCAACTGGTGTCGTGG This paper N/A miR-485-5p Forward(5’to 3’): CTTAAGTAGTGCCGGTC This paper N/A miR-485-5p Reverse(5’to 3’): GCAGGGTCCGAGGTATTC This paper N/A miR-412-5p Forward (5’to 3’): GGTACGGGGATGGATGGTC This paper N/A miR-412-5p Reverse(5’to 3’): GGATACGGACGGCTAGTGGA This paper N/A miR-23b-5p Forward (5’to 3’):

    Enzyme-linked Immunosorbent Assay:

    Article Title: Diagnostic ultrasound-microbubble therapy promotes wound healing through miR-26b-5p-mediated GSK3β suppression.
    Article Snippet: Rabbit monoclonal anti-CD31 Abcam Cat#EPR17259 RRID:ab182981 Rabbit Polyclonal anti-Phospho-GSK3B Proteintech Cat#14850-1-AP RRID:ab2878085 Mouse monoclonal anti-GAPDH Proteintech Cat#60004-1-Ig RRID:ab2107436 Rabbit polyclonal anti-Phospho-AKT Proteintech Cat#28731-1-AP RRID:ab2881201 Mouse monoclonal anti-Phospho-Pi3k Proteintech Cat#60225-1-Ig RRID:11042594 Biological samples Sprague Dawley (SD) rats Chen Du Dossy N/A Chemicals, peptides, and recombinant proteins rno-miR-26b-5p inhibitor RiboBio N/A .. Hematoxylin-Eosin(HE) Stain Kit SOLARBIO Cat#G1120 Masson’s Trichrome Stain Kit SOLARBIO Cat#G1340 Rat TNF-α ELISA Kit Elabscience Cat#E-EL-R2856 Rat TGF-β ELISA Kit Elabscience Cat#E-EL-0162c Rat IL-1β ELISA Kit Elabscience Cat#E-EL-R0012c Rat VEGF ELISA Kit Elabscience CatE-EL-R2603c DAB kit Bioss Cat#C-0010 Dual-Luciferase® Reporter Assay System Promega Cat#E1910 Bulge-Loop miRNA qRT-PCR Starter Kit RiboBio Cat#C10211-2 Bulge-LoopTM miRNA qRT-PCR Primer RiboBio Cat#MQP-0102 PrimeScriptTM RT reagent Kit Takara Cat#RR037A 24-well Transwell plate Corning Cat#3422 96-well Transwell plates Corning Cat#3382 SonoVue Bracco H20120528 Experimental models: Cell lines Human umbilical vein endothelial cell line Pricella CP-H082 .. Sprague Dawley (SD) rats Chen Du N/A AR TIC LE IN PR ES S 26 Dossy Oligonucleotides rno-miR-26b-5p Forward(5’to 3’): TTCAAGTAATTCAGGATAGGT This paper N/A rno-miR-26b-5p Reverse(5’to 3’): GCAGGGTCCGAGGTATTC This paper N/A miR-433-3p Forward(5’to 3’): TCGGCAATCATGATGGGC This paper N/A miR-433-3p Reverse(5’to 3’): CTCAACTGGTGTCGTGG This paper N/A miR-485-5p Forward(5’to 3’): CTTAAGTAGTGCCGGTC This paper N/A miR-485-5p Reverse(5’to 3’): GCAGGGTCCGAGGTATTC This paper N/A miR-412-5p Forward (5’to 3’): GGTACGGGGATGGATGGTC This paper N/A miR-412-5p Reverse(5’to 3’): GGATACGGACGGCTAGTGGA This paper N/A miR-23b-5p Forward (5’to 3’):

    Reporter Assay:

    Article Title: Diagnostic ultrasound-microbubble therapy promotes wound healing through miR-26b-5p-mediated GSK3β suppression.
    Article Snippet: Rabbit monoclonal anti-CD31 Abcam Cat#EPR17259 RRID:ab182981 Rabbit Polyclonal anti-Phospho-GSK3B Proteintech Cat#14850-1-AP RRID:ab2878085 Mouse monoclonal anti-GAPDH Proteintech Cat#60004-1-Ig RRID:ab2107436 Rabbit polyclonal anti-Phospho-AKT Proteintech Cat#28731-1-AP RRID:ab2881201 Mouse monoclonal anti-Phospho-Pi3k Proteintech Cat#60225-1-Ig RRID:11042594 Biological samples Sprague Dawley (SD) rats Chen Du Dossy N/A Chemicals, peptides, and recombinant proteins rno-miR-26b-5p inhibitor RiboBio N/A .. Hematoxylin-Eosin(HE) Stain Kit SOLARBIO Cat#G1120 Masson’s Trichrome Stain Kit SOLARBIO Cat#G1340 Rat TNF-α ELISA Kit Elabscience Cat#E-EL-R2856 Rat TGF-β ELISA Kit Elabscience Cat#E-EL-0162c Rat IL-1β ELISA Kit Elabscience Cat#E-EL-R0012c Rat VEGF ELISA Kit Elabscience CatE-EL-R2603c DAB kit Bioss Cat#C-0010 Dual-Luciferase® Reporter Assay System Promega Cat#E1910 Bulge-Loop miRNA qRT-PCR Starter Kit RiboBio Cat#C10211-2 Bulge-LoopTM miRNA qRT-PCR Primer RiboBio Cat#MQP-0102 PrimeScriptTM RT reagent Kit Takara Cat#RR037A 24-well Transwell plate Corning Cat#3422 96-well Transwell plates Corning Cat#3382 SonoVue Bracco H20120528 Experimental models: Cell lines Human umbilical vein endothelial cell line Pricella CP-H082 .. Sprague Dawley (SD) rats Chen Du N/A AR TIC LE IN PR ES S 26 Dossy Oligonucleotides rno-miR-26b-5p Forward(5’to 3’): TTCAAGTAATTCAGGATAGGT This paper N/A rno-miR-26b-5p Reverse(5’to 3’): GCAGGGTCCGAGGTATTC This paper N/A miR-433-3p Forward(5’to 3’): TCGGCAATCATGATGGGC This paper N/A miR-433-3p Reverse(5’to 3’): CTCAACTGGTGTCGTGG This paper N/A miR-485-5p Forward(5’to 3’): CTTAAGTAGTGCCGGTC This paper N/A miR-485-5p Reverse(5’to 3’): GCAGGGTCCGAGGTATTC This paper N/A miR-412-5p Forward (5’to 3’): GGTACGGGGATGGATGGTC This paper N/A miR-412-5p Reverse(5’to 3’): GGATACGGACGGCTAGTGGA This paper N/A miR-23b-5p Forward (5’to 3’):

    Quantitative RT-PCR:

    Article Title: Diagnostic ultrasound-microbubble therapy promotes wound healing through miR-26b-5p-mediated GSK3β suppression.
    Article Snippet: Rabbit monoclonal anti-CD31 Abcam Cat#EPR17259 RRID:ab182981 Rabbit Polyclonal anti-Phospho-GSK3B Proteintech Cat#14850-1-AP RRID:ab2878085 Mouse monoclonal anti-GAPDH Proteintech Cat#60004-1-Ig RRID:ab2107436 Rabbit polyclonal anti-Phospho-AKT Proteintech Cat#28731-1-AP RRID:ab2881201 Mouse monoclonal anti-Phospho-Pi3k Proteintech Cat#60225-1-Ig RRID:11042594 Biological samples Sprague Dawley (SD) rats Chen Du Dossy N/A Chemicals, peptides, and recombinant proteins rno-miR-26b-5p inhibitor RiboBio N/A .. Hematoxylin-Eosin(HE) Stain Kit SOLARBIO Cat#G1120 Masson’s Trichrome Stain Kit SOLARBIO Cat#G1340 Rat TNF-α ELISA Kit Elabscience Cat#E-EL-R2856 Rat TGF-β ELISA Kit Elabscience Cat#E-EL-0162c Rat IL-1β ELISA Kit Elabscience Cat#E-EL-R0012c Rat VEGF ELISA Kit Elabscience CatE-EL-R2603c DAB kit Bioss Cat#C-0010 Dual-Luciferase® Reporter Assay System Promega Cat#E1910 Bulge-Loop miRNA qRT-PCR Starter Kit RiboBio Cat#C10211-2 Bulge-LoopTM miRNA qRT-PCR Primer RiboBio Cat#MQP-0102 PrimeScriptTM RT reagent Kit Takara Cat#RR037A 24-well Transwell plate Corning Cat#3422 96-well Transwell plates Corning Cat#3382 SonoVue Bracco H20120528 Experimental models: Cell lines Human umbilical vein endothelial cell line Pricella CP-H082 .. Sprague Dawley (SD) rats Chen Du N/A AR TIC LE IN PR ES S 26 Dossy Oligonucleotides rno-miR-26b-5p Forward(5’to 3’): TTCAAGTAATTCAGGATAGGT This paper N/A rno-miR-26b-5p Reverse(5’to 3’): GCAGGGTCCGAGGTATTC This paper N/A miR-433-3p Forward(5’to 3’): TCGGCAATCATGATGGGC This paper N/A miR-433-3p Reverse(5’to 3’): CTCAACTGGTGTCGTGG This paper N/A miR-485-5p Forward(5’to 3’): CTTAAGTAGTGCCGGTC This paper N/A miR-485-5p Reverse(5’to 3’): GCAGGGTCCGAGGTATTC This paper N/A miR-412-5p Forward (5’to 3’): GGTACGGGGATGGATGGTC This paper N/A miR-412-5p Reverse(5’to 3’): GGATACGGACGGCTAGTGGA This paper N/A miR-23b-5p Forward (5’to 3’):



    Similar Products

    e el r2603c dab kit bioss  (Bioss)
    96
    Bioss e el r2603c dab kit bioss
    E El R2603c Dab Kit Bioss, supplied by Bioss, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/e+el+r2603c+dab+kit+bioss/Rat+Catalase+(CAT)+ELISA+Kit/pm41345441-306-34-37
    Average 96 stars, based on 1 article reviews
    e el r2603c dab kit bioss - by Bioz Stars, 2026-09
    96/100 stars
    		  Buy from Supplier

    Image Search Results